Ppfia1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ppfia1em1(IMPC)J |
| Name: |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6188059 |
| Gene: |
Ppfia1 Location: Chr7:144030495-144107466 bp, - strand Genetic Position: Chr7, 88.85 cM
|
| Alliance: |
Ppfia1em1(IMPC)J page
|
| IMPC: |
Ppfia1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCAGCTCTGTGGGTATGCAA, GCAACTCTCTCACATGGACT, GCTGCTGTCTCTGCGGGCGT and GGTGATAGACAAGTTAAAAG, which resulted in a 330 bp deletion beginning at Chromosome 7 position 144,510,211 bp and ending after 144,510,540 bp (GRCm38/mm10). This deletes ENSMUSE00000873361 (exon 13) and 250 bp of flanking intronic sequence including the splice acceptor and donor. In addition, a 55 bp sequence corresponding to Chr 7:144512416-144512470, from the upstream intron between exons 11 and 12, and inserted into the deletion site. This mutation is predicted to cause a change of amino acid sequence after residue 496 and early truncation 41 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|