About   Help   FAQ
Ppfia1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ppfia1em1(IMPC)J
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6188059
Gene: Ppfia1  Location: Chr7:144030495-144107466 bp, - strand  Genetic Position: Chr7, 88.85 cM
Alliance: Ppfia1em1(IMPC)J page
IMPC: Ppfia1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCAGCTCTGTGGGTATGCAA, GCAACTCTCTCACATGGACT, GCTGCTGTCTCTGCGGGCGT and GGTGATAGACAAGTTAAAAG, which resulted in a 330 bp deletion beginning at Chromosome 7 position 144,510,211 bp and ending after 144,510,540 bp (GRCm38/mm10). This deletes ENSMUSE00000873361 (exon 13) and 250 bp of flanking intronic sequence including the splice acceptor and donor. In addition, a 55 bp sequence corresponding to Chr 7:144512416-144512470, from the upstream intron between exons 11 and 12, and inserted into the deletion site. This mutation is predicted to cause a change of amino acid sequence after residue 496 and early truncation 41 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ppfia1 Mutation:  45 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory