Lrrc41em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Lrrc41em1(IMPC)J |
| Name: |
leucine rich repeat containing 41; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6161420 |
| Gene: |
Lrrc41 Location: Chr4:115932466-115954240 bp, + strand Genetic Position: Chr4, 53.1 cM
|
| Alliance: |
Lrrc41em1(IMPC)J page
|
| IMPC: |
Lrrc41 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences AGGTATCACTTGTCAGACAA, CTATTGGAGGAAAGGCCAAG, AAGGTATCACTTGTCAGACA and GCACTGTGCCTAATCAAGAG, which resulted in a 1426 bp deletion beginning at Chromosome 4 position 116,088,205 bp and ending after 116,089,630 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000181518 (exon 4) and 303 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is an 11bp deletion (CTTGGCCTTTC) 128 bp before the exon deletion, and a 16 bp insertion (AAACCTAGATTTGTGC) at the deletion site. This mutation is predicted to cause a change of amino acid sequence after residue 119 and early truncation 40 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|