Sf3b3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sf3b3^em1(IMPC)J
• Name: splicing factor 3b, subunit 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6159653
• Gene: Sf3b3 Location: Chr8:111537123-111573578 bp, - strand Genetic Position: Chr8, 57.73 cM
• Alliance: Sf3b3^em1(IMPC)J page
• IMPC: Sf3b3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGACATGACGAAAACAGCCA, TTGTTGTCTGCTAACAGTAG, GACCTGAGATATTTATTGAG and CAGTGTATTTGTACAGTTAG, which resulted in a 498 bp deletion beginning at Chromosome 8 position 110,841,393 bp and ending after 110,841,890 bp (GRCm38/mm10). This mutation deletes the last 120 bp of ENSMUSE00000311482 (exon 4) and 378 bp of flanking intronic sequence including the splice donor and is predicted to cause a change of amino acid sequence after residue 150 and early truncation 7 amino acids later, probably by read through in the intron after the deletion. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Sf3b3 Mutation: 88 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)