About   Help   FAQ
Sf3b3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Sf3b3em1(IMPC)J
Name: splicing factor 3b, subunit 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6159653
Gene: Sf3b3  Location: Chr8:111537123-111573578 bp, - strand  Genetic Position: Chr8, 57.73 cM
Alliance: Sf3b3em1(IMPC)J page
IMPC: Sf3b3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGACATGACGAAAACAGCCA, TTGTTGTCTGCTAACAGTAG, GACCTGAGATATTTATTGAG and CAGTGTATTTGTACAGTTAG, which resulted in a 498 bp deletion beginning at Chromosome 8 position 110,841,393 bp and ending after 110,841,890 bp (GRCm38/mm10). This mutation deletes the last 120 bp of ENSMUSE00000311482 (exon 4) and 378 bp of flanking intronic sequence including the splice donor and is predicted to cause a change of amino acid sequence after residue 150 and early truncation 7 amino acids later, probably by read through in the intron after the deletion. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Sf3b3 Mutation:  88 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory