Prkab1^em2(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prkab1^em2(IMPC)Mbp
• Name: protein kinase, AMP-activated, beta 1 non-catalytic subunit; endonuclease-mediated mutation 2, Mouse Biology Program, UC Davis
• MGI ID: MGI:6158483
• Gene: Prkab1 Location: Chr5:116151654-116162449 bp, - strand Genetic Position: Chr5, 56.1 cM, cytoband F
• Alliance: Prkab1^em2(IMPC)Mbp page
• IMPC: Prkab1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from IMPC was generated at UC Davis by injecting CAS9 RNA and the guide sequence CCCTCCGCGGCGTCTTGTGGCCC, which resulted in a Indel. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Prkab1 Mutation: 25 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)