About   Help   FAQ
Dnajc13em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dnajc13em1(IMPC)J
Name: DnaJ heat shock protein family (Hsp40) member C13; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6157328
Synonyms: Dnajc13-
Gene: Dnajc13  Location: Chr9:104028481-104140129 bp, - strand  Genetic Position: Chr9, 56.61 cM
Alliance: Dnajc13em1(IMPC)J page
IMPC: Dnajc13 gene page
Dnajc13em1(IMPC)J/Dnajc13em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts hatch from the zona pellucida and form outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intergenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATGCTTTCTAGACTCTCGA, GTTCCCACTAAAATAAGTGG, CTGACTTCAGCAGGGAAGAT and ATAGTTCCCACTAAAATAAG, which resulted in a 495 bp deletion beginning at Chromosome 9 position 104,238,263 bp and ending after 104,238,757 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000395222 (exon 3) and 419 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 22 and early truncation 35 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Dnajc13 Mutation:  83 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory