Dnajc13em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Dnajc13em1(IMPC)J |
| Name: |
DnaJ heat shock protein family (Hsp40) member C13; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6157328 |
| Synonyms: |
Dnajc13- |
| Gene: |
Dnajc13 Location: Chr9:104028481-104140129 bp, - strand Genetic Position: Chr9, 56.61 cM
|
| Alliance: |
Dnajc13em1(IMPC)J page
|
| IMPC: |
Dnajc13 gene page |
|
Dnajc13em1(IMPC)J/Dnajc13em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts hatch from the zona pellucida and form outgrowths.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intergenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATGCTTTCTAGACTCTCGA, GTTCCCACTAAAATAAGTGG, CTGACTTCAGCAGGGAAGAT and ATAGTTCCCACTAAAATAAG, which resulted in a 495 bp deletion beginning at Chromosome 9 position 104,238,263 bp and ending after 104,238,757 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000395222 (exon 3) and 419 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 22 and early truncation 35 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|