About   Help   FAQ
Top2aem2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Top2aem2(IMPC)Tcp
Name: topoisomerase (DNA) II alpha; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6157267
Gene: Top2a  Location: Chr11:98883769-98915015 bp, - strand  Genetic Position: Chr11, 62.91 cM
Alliance: Top2aem2(IMPC)Tcp page
IMPC: Top2a gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0590 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of GCCCTGCATAAGAACATGGG and GTCAGCATGTATTTTGGGTC targeting the 5' side and TTTGAGTTAGAGTGCAGTAT and ATGCCTGTGCCTGATCTGAC targeting the 3' side of exons ENSMUSE00000648121 (exon 6), ENSMUSE00000648120 (exon 7), ENSMUSE00000648119 (exon 8), ENSMUSE00000648118 (exon 9), and ENSMUSE00000648117 (exon 10). This resulted in a 2,899-bp deletion of Chr11 from 99014059 to 99016957_ins.GATA and a 9-bp deletion of Chr11 from 99013968 to 99013976 (GRCm38). (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 7 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Top2a Mutation:  88 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory