About   Help   FAQ
Sclt1em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Sclt1em1(IMPC)Tcp
Name: sodium channel and clathrin linker 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156476
Gene: Sclt1  Location: Chr3:41581155-41696949 bp, - strand  Genetic Position: Chr3, 19.91 cM, cytoband C
Alliance: Sclt1em1(IMPC)Tcp page
IMPC: Sclt1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0927 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GTTGCTATGGTAAGCAGACA and TTCAAGGGATAGCAATCAGC targeting the 5' side and ATGGATAAATGTATCAGGGT and TGAATTCGGCTTATATTCTT targeting the 3' side of a critical region. This resulted in a 2,043-bp deletion Chr3:41725596 to 41727638 (GRCm38). (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Sclt1 Mutation:  37 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory