Ier3ip1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ier3ip1em1(IMPC)J |
| Name: |
immediate early response 3 interacting protein 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6154001 |
| Gene: |
Ier3ip1 Location: Chr18:77017723-77029310 bp, + strand Genetic Position: Chr18, 51.98 cM
|
| Alliance: |
Ier3ip1em1(IMPC)J page
|
| IMPC: |
Ier3ip1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTATACTTAATATCTTCACAGGG, TCAGTCTTCAGGGCTGTCAGCGG, CCATCTTTACTGAACTGAACACC and CCTTGCGTAACTTTTAAGTTACT, which resulted in a 2581 bp deletion beginning at Chromosome 18 position 76,939,313 bp and ending after 76,941,893 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001271873 and ENSMUSE00001293257 (exons 2 and 3) and 1386 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 30 and early truncation 11 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|