Tgm3^{em1(IMPC)Wtsi}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tgm3^{em1(IMPC)Wtsi}
• Name: transglutaminase 3, E polypeptide; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
• MGI ID: MGI:6153760
• Gene: Tgm3 Location: Chr2:129854269-129892319 bp, + strand Genetic Position: Chr2, 63.19 cM
• Alliance: Tgm3^{em1(IMPC)Wtsi} page
• IMPC: Tgm3 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Single point mutation
• Mutation details: This allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA, the guide sequence GATTCTGGCATCATCTATGTGGG, and a donor oligo, which resulted in a Point Mutation allele. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tgm3 Mutation: 56 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 1 reference(s)