About   Help   FAQ
Myocdem1Bph
Endonuclease-mediated Allele Detail
Summary
Symbol: Myocdem1Bph
Name: myocardin; endonuclease-mediated mutation 1, B Paul Herring
MGI ID: MGI:6153127
Gene: Myocd  Location: Chr11:65067387-65160815 bp, - strand  Genetic Position: Chr11, 40.42 cM
Alliance: Myocdem1Bph page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Epitope tag, No functional change)
Mutation:    Insertion
 
Mutation detailsA signal guide RNA (ACAGCAGUGGUAAACACCCG) and the cas9 nuclease are used to introduce a myc-HA epitope tag within the carboxy terminus of the gene. (J:285162)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Myocd Mutation:  55 strains or lines available
References
Original:  J:285162 Lyu Q, et al., CRISPR-Cas9-Mediated Epitope Tagging Provides Accurate and Versatile Assessment of Myocardin-Brief Report. Arterioscler Thromb Vasc Biol. 2018 Sep;38(9):2184-2190
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory