Myocd^em1Bph
Endonuclease-mediated Allele Detail

Summary

• Symbol: Myocd^em1Bph
• Name: myocardin; endonuclease-mediated mutation 1, B Paul Herring
• MGI ID: MGI:6153127
• Gene: Myocd Location: Chr11:65067387-65160815 bp, - strand Genetic Position: Chr11, 40.42 cM
• Alliance: Myocd^em1Bph page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Epitope tag, No functional change)
• Mutation: Insertion
• Mutation details: A signal guide RNA (ACAGCAGUGGUAAACACCCG) and the cas9 nuclease are used to introduce a myc-HA epitope tag within the carboxy terminus of the gene. (J:285162)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Myocd Mutation: 55 strains or lines available

References

• Original: J:285162 Lyu Q, et al., CRISPR-Cas9-Mediated Epitope Tagging Provides Accurate and Versatile Assessment of Myocardin-Brief Report. Arterioscler Thromb Vasc Biol. 2018 Sep;38(9):2184-2190
• All: 1 reference(s)