Rtl5^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rtl5^em1(IMPC)Mbp
• Name: retrotransposon Gag like 5; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6152725
• Synonyms: Rgag4^em1(IMPC)Mbp
• Gene: Rtl5 Location: ChrX:101110150-101114910 bp, - strand Genetic Position: ChrX, 45.06 cM
• Alliance: Rtl5^em1(IMPC)Mbp page
• IMPC: Rtl5 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences CGTCCCGGACCGAGCCCCTG, CGTGGGAGGAGACCAACGTG, GGGGAAGGGTGTGTTCCCCG, and GTACGAAAGCCCCAGACTGG that targeted exon(s) ENSMUSE00001329502.2 ENSMUSE00000696475.2. This resulted in deletion(s) of 3 bp (location: ChrX:101114866-101114868; GRCm39), 2082 bp (location: ChrX:101112556-101114637; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rtl5 Mutation: 4 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)