About   Help   FAQ
Zc3h4em1(IMPC)Mbp
Endonuclease-mediated Allele Detail
Summary
Symbol: Zc3h4em1(IMPC)Mbp
Name: zinc finger CCCH-type containing 4; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
MGI ID: MGI:6152686
Synonyms: Zc3h4-
Gene: Zc3h4  Location: Chr7:16133534-16171621 bp, + strand  Genetic Position: Chr7, 9.03 cM
Alliance: Zc3h4em1(IMPC)Mbp page
IMPC: Zc3h4 gene page
Zc3h4em1(IMPC)Mbp/Zc3h4em1(IMPC)Mbp mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but no embryos at E7.5. Blastocysts in vitro fail to hatch from the zona pellucida.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at UC Davis by injecting CAS9 Protein and 3 guide sequences GTCTGCTATGGCTACCAAGGAGG, CCTCCACTCCTGGACTTTCATCA, GTAGATAACTACGATACGGGAGG, which resulted in an Exon Deletion. The entire exon 4 (ENSMUSE00000895527, 223 bp) was deleted generating a frame-shifted knockout allele. (J:237616, J:301719)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 12 assay results
In Structures Affected by this Mutation: 8 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Zc3h4 Mutation:  177 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory