About   Help   FAQ
Wbp2nlem1(IMPC)Mbp
Endonuclease-mediated Allele Detail
Summary
Symbol: Wbp2nlem1(IMPC)Mbp
Name: WBP2 N-terminal like; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
MGI ID: MGI:6152677
Gene: Wbp2nl  Location: Chr15:82183155-82198824 bp, + strand  Genetic Position: Chr15, 38.56 cM, cytoband E2
Alliance: Wbp2nlem1(IMPC)Mbp page
IMPC: Wbp2nl gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences AAAGGAAAGCGTAAATTACC and GTCCAGCTTCTCTCCGAATG. This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Wbp2nl Mutation:  30 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory