About   Help   FAQ
Rbbp4em1(IMPC)Mbp
Endonuclease-mediated Allele Detail
Summary
Symbol: Rbbp4em1(IMPC)Mbp
Name: retinoblastoma binding protein 4, chromatin remodeling factor; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
MGI ID: MGI:6152622
Synonyms: Rbbp4-
Gene: Rbbp4  Location: Chr4:129200893-129229163 bp, - strand  Genetic Position: Chr4, 63.26 cM, cytoband D2.3
Alliance: Rbbp4em1(IMPC)Mbp page
IMPC: Rbbp4 gene page
Rbbp4em1(IMPC)Mbp/Rbbp4em1(IMPC)Mbp mice exhibit embryonic lethality, with only 3% of embryos recovered at E3.5 as blastocysts and no embryos at E7.5. Blastocysts in vitro hatch from the zona pellucida but fail to form typical outgrowth colonies.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at UC Davis by injecting CAS9 RNA and 4 guide sequences TGAGTTCAATATGGTGCTAGGGG, TGTACCTGGAAAAAACCTAGGGG, CCAGAGGACAATTAGTCATCACT, CCTTAAGTTCAAGCACAGGAACA, which resulted in an Exon Deletion. Exon 3 (ENSMUSE00001236831) and flanking splicing regions were deleted. RT-PCR analysis confirmed the absence of Rbbp4 expression in homozygous mutant blastocysts. (J:237616, J:290528)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 6 assay results
In Structures Affected by this Mutation: 9 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rbbp4 Mutation:  34 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  6 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory