Rbbp4^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rbbp4^em1(IMPC)Mbp
• Name: retinoblastoma binding protein 4, chromatin remodeling factor; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6152622
• Synonyms: Rbbp4^-
• Gene: Rbbp4 Location: Chr4:129200893-129229163 bp, - strand Genetic Position: Chr4, 63.26 cM, cytoband D2.3
• Alliance: Rbbp4^em1(IMPC)Mbp page
• IMPC: Rbbp4 gene page

Rbbp4^em1(IMPC)Mbp/Rbbp4^em1(IMPC)Mbp mice exhibit embryonic lethality, with only 3% of embryos recovered at E3.5 as blastocysts and no embryos at E7.5. Blastocysts in vitro hatch from the zona pellucida but fail to form typical outgrowth colonies.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at UC Davis by injecting CAS9 RNA and 4 guide sequences TGAGTTCAATATGGTGCTAGGGG, TGTACCTGGAAAAAACCTAGGGG, CCAGAGGACAATTAGTCATCACT, CCTTAAGTTCAAGCACAGGAACA, which resulted in an Exon Deletion. Exon 3 (ENSMUSE00001236831) and flanking splicing regions were deleted. RT-PCR analysis confirmed the absence of Rbbp4 expression in homozygous mutant blastocysts. (J:237616, J:290528)

Expression

In Mice Carrying this Mutation:	6 assay results
In Structures Affected by this Mutation:	9 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rbbp4 Mutation: 34 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 6 reference(s)