Col22a1^{em1(IMPC)Rbrc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Col22a1^{em1(IMPC)Rbrc}
• Name: collagen, type XXII, alpha 1; endonuclease-mediated mutation 1, RIKEN BioResource Center
• MGI ID: MGI:6148316
• Synonyms: Col22a1^em1Rbrc
• Gene: Col22a1 Location: Chr15:71667644-71906076 bp, - strand Genetic Position: Chr15, 32.31 cM
• Alliance: Col22a1^{em1(IMPC)Rbrc} page
• IMPC: Col22a1 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from IMPC was generated at RIKEN BioResource Center by injecting D10A RNA and 2 guide sequences GGTAGTCCAGGAGGTCCCTGGGG, CCCAGCAGGCCCTGGTAGTCCAG, which resulted in a Indel. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Col22a1 Mutation: 80 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)