About   Help   FAQ
Col22a1em1(IMPC)Rbrc
Endonuclease-mediated Allele Detail
Summary
Symbol: Col22a1em1(IMPC)Rbrc
Name: collagen, type XXII, alpha 1; endonuclease-mediated mutation 1, RIKEN BioResource Center
MGI ID: MGI:6148316
Synonyms: Col22a1em1Rbrc
Gene: Col22a1  Location: Chr15:71667644-71906076 bp, - strand  Genetic Position: Chr15, 32.31 cM
Alliance: Col22a1em1(IMPC)Rbrc page
IMPC: Col22a1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NTac
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at RIKEN BioResource Center by injecting D10A RNA and 2 guide sequences GGTAGTCCAGGAGGTCCCTGGGG, CCCAGCAGGCCCTGGTAGTCCAG, which resulted in a Indel. (J:237616)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Col22a1 Mutation:  80 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory