Svopl^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Svopl^em1(IMPC)J
• Name: SV2 related protein homolog (rat)-like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6111442
• Gene: Svopl Location: Chr6:37960674-38023931 bp, - strand Genetic Position: Chr6, 17.34 cM
• Alliance: Svopl^em1(IMPC)J page
• IMPC: Svopl gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Svop1-111592J-4927M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAGCTTGCAGCTACTCCACG, AATTCAAGACTCCATCTTAG, ATACCTGTAGAGGTGGGCCA and GGCAGAGTATGAGAACCACT, which resulted in a 376 bp deletion beginning at Chromosome 6 negative strand position 38,041,189 bp and ending after 38,040,814 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001309504 (exon 3) and 284 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 27 and early truncation 19 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Svopl Mutation: 21 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)