About   Help   FAQ
Svoplem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Svoplem1(IMPC)J
Name: SV2 related protein homolog (rat)-like; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6111442
Gene: Svopl  Location: Chr6:37960674-38023931 bp, - strand  Genetic Position: Chr6, 17.34 cM
Alliance: Svoplem1(IMPC)J page
IMPC: Svopl gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Svop1-111592J-4927M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAGCTTGCAGCTACTCCACG, AATTCAAGACTCCATCTTAG, ATACCTGTAGAGGTGGGCCA and GGCAGAGTATGAGAACCACT, which resulted in a 376 bp deletion beginning at Chromosome 6 negative strand position 38,041,189 bp and ending after 38,040,814 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001309504 (exon 3) and 284 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 27 and early truncation 19 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Svopl Mutation:  21 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory