About   Help   FAQ
Spata3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Spata3em1(IMPC)J
Name: spermatogenesis associated 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6107629
Gene: Spata3  Location: Chr1:85945728-85957683 bp, + strand  Genetic Position: Chr1, 43.94 cM, cytoband C5
Alliance: Spata3em1(IMPC)J page
IMPC: Spata3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGATTCTAGCAGGTGTTGTA, GTGTCCCACTCCCAAGAACC, TTACAATGGGCTGGGTGGGA and GAGTTTACAATGGGCTGGGT, which resulted in a 531 bp deletion beginning at Chromosome 1 positive strand position 86,024,199 bp and ending after 86,024,729 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000695237 (exon 4) and 356 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an indel with an 8bp insertion (GGTTTTTT) and a 10 bp deletion (TGTCTATTTA) 85 bp after the 531 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 100 and truncation 38 amino acids later by read through of the stop codon into the 3 untranslated sequence. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Spata3 Mutation:  15 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory