Spata3em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Spata3em1(IMPC)J |
Name: |
spermatogenesis associated 3; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6107629 |
Gene: |
Spata3 Location: Chr1:85945728-85957683 bp, + strand Genetic Position: Chr1, 43.94 cM, cytoband C5
|
Alliance: |
Spata3em1(IMPC)J page
|
IMPC: |
Spata3 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGATTCTAGCAGGTGTTGTA, GTGTCCCACTCCCAAGAACC, TTACAATGGGCTGGGTGGGA and GAGTTTACAATGGGCTGGGT, which resulted in a 531 bp deletion beginning at Chromosome 1 positive strand position 86,024,199 bp and ending after 86,024,729 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000695237 (exon 4) and 356 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an indel with an 8bp insertion (GGTTTTTT) and a 10 bp deletion (TGTCTATTTA) 85 bp after the 531 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 100 and truncation 38 amino acids later by read through of the stop codon into the 3 untranslated sequence.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|