Serpina3k^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Serpina3k^em1(IMPC)J
• Name: serine (or cysteine) peptidase inhibitor, clade A, member 3K; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6107619
• Synonyms: KOSA3
• Gene: Serpina3k Location: Chr12:104304745-104311998 bp, + strand Genetic Position: Chr12, 53.99 cM, cytoband F1
• Alliance: Serpina3k^em1(IMPC)J page
• IMPC: Serpina3k gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCTTCCTATCCATGCCTAG, GGTCCCGAGAGTGTTTACAG, GCACCTACAATACACTACAG and GCAACATACAGTACACTGCA, which resulted in a 580 bp deletion beginning at Chromosome 12 positive strand position 104,343,940 bp and ending after 104,344,519 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000256671 (exon 4) and 426 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 22 bp deletion 21 bp after the exon deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 304 and early truncation 41 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Serpina3k Mutation: 29 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)