About   Help   FAQ
Cntnap3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cntnap3em1(IMPC)J
Name: contactin associated protein-like 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6106859
Gene: Cntnap3  Location: Chr13:64883996-65051769 bp, - strand  Genetic Position: Chr13, 33.46 cM
Alliance: Cntnap3em1(IMPC)J page
IMPC: Cntnap3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTAGAAGTCTCATAACACT, AAGTAATTTTTAACTGACGC, TCACTCTGCCTATATCCAAA and ATTATCATAGCTTATATCAA, which resulted in a 278 bp deletion beginning at Chromosome 13 negative strand position 64,799,280 bp and ending after 64,799,003 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000321093 (exon 4) and 130 bp of flanking intronic sequence including the splice acceptor and donor. There are 2 additional small deletions, a 5 bp (GGATA) deletion 29 bp before the exon deletion and a 2 bp deletion (GT) 53 bp after he 278 bp deletion, neither of which will alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 133 and early truncation 21 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cntnap3 Mutation:  57 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory