Kcnk16em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Kcnk16em1(IMPC)J |
| Name: |
potassium channel, subfamily K, member 16; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6094223 |
| Gene: |
Kcnk16 Location: Chr14:20311444-20319267 bp, - strand Genetic Position: Chr14, 11.49 cM, cytoband B
|
| Alliance: |
Kcnk16em1(IMPC)J page
|
| IMPC: |
Kcnk16 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGAATATGCTTTATCCCGG, AATGGACCCCAAGCTCAGCA, CTAAGACACTAAGTGGCCAG and CTTAGGCCCTGGCTTCCCAC, which resulted in a 400 bp deletion beginning at Chromosome 14 positive strand position 20,265,075 bp and ending after 20,265,474 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000239215 (exon 2) and 285 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 72 and early truncation 19 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|