About   Help   FAQ
Rpainem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rpainem1(IMPC)J
Name: RPA interacting protein; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5911998
Synonyms: Rpain-
Gene: Rpain  Location: Chr11:70861039-70868659 bp, + strand  Genetic Position: Chr11, 43.21 cM, cytoband B4
Alliance: Rpainem1(IMPC)J page
IMPC: Rpain gene page
Rpainem1(IMPC)J/Rpainem1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocyts but not at E7.5. Blastocysts hatch from the zona pellucida and form outgrowths with few trophectoderm cells.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTACTGGATAAAATTGGCC, CATTTGTTGTTAGTTCAGCT, GCAAAGGCCAGCATTAGGGT and GGTAGGGAAGACTCTGCCCT, which resulted in a 215 bp deletion beginning at Chromosome 11 positive strand position 70,972,871 bp and ending after 70,973,085 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001257298 (exon 3) and 154 bp of flanking intronic sequence including the splice acceptor and donor. In addition there are a couple of indels including an 11 bp insertion (CTGCTCAGAGA) at the deletion site, and a 4 bp insertion (TCAG) and 15 bp deletion (CTAATGCTGGCCTTT) 31 bp after the exon deletion. These indels will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 84 and early truncation 4 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rpain Mutation:  17 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory