Riok1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Riok1em1(IMPC)J |
Name: |
RIO kinase 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5911955 |
Gene: |
Riok1 Location: Chr13:38220971-38245409 bp, + strand Genetic Position: Chr13, 17.91 cM
|
Alliance: |
Riok1em1(IMPC)J page
|
IMPC: |
Riok1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GCAAAGCCAACACCCACTGA, ATTCATACACCTACTTTCAG and GGGATCCACAACATCTAAGC, which resulted in a 626 bp deletion beginning at Chromosome 13 positive strand position 38,039,914 bp and ending after 38,040,539 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000117768 (exon 2) and 424 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a small 6 bp (TGAAAG) deletion 121 bp before the 626 bp del that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 23 and early truncation 30 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
4 reference(s) |
|