Riok1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Riok1^em1(IMPC)J
• Name: RIO kinase 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5911955
• Synonyms: Riok1^-
• Gene: Riok1 Location: Chr13:38220971-38245409 bp, + strand Genetic Position: Chr13, 17.91 cM
• Alliance: Riok1^em1(IMPC)J page
• IMPC: Riok1 gene page

Riok1^em1(IMPC)J/Riok1^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts grown in vitro hatch from the zona pellucida and form normal outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences ATTCATACACCTACTTTCAG, GCAAAGCCAACACCCACTGA, and GGGATCCACAACATCTAAGC that targeted exon(s) ENSMUSE00000117768.2. This resulted in deletion(s) of 6 bp (location: Chr13:38223763-38223768; GRCm39), 85 bp (location: Chr13:38224431-38224515; GRCm39), and 538 bp (location: Chr13:38223890-38224427; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Riok1 Mutation: 29 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)