Wnk2em1Murr
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Wnk2em1Murr |
| Name: |
WNK lysine deficient protein kinase 2; endonuclease-mediated mutation 1, Stephen Murray |
| MGI ID: |
MGI:5911092 |
| Gene: |
Wnk2 Location: Chr13:49189779-49301490 bp, - strand Genetic Position: Chr13, 25.07 cM, cytoband B1
|
| Alliance: |
Wnk2em1Murr page
|
| IMPC: |
Wnk2 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AAGCGATAGAGACTTCACCC, TTCACCCTGGAGCCCCTGCG, CAGCCTTGAGTGACAAGACC and CAAGCCTCACCCAGCAGACC, which resulted in 2 small deletions, a 7 bp (GGCTGAG) deletion beginning at Chromosome 13 positive strand position 49,060,745 bp and ending after 49,060,752 bp, followed 27 bp later by a 6 bp deletion (GTGGAG) beginning at Chromosome 13 positive strand position 49,060,753 bp and ending after 49,060,759 bp (GRCm38/mm10). This mutation deletes 13 total bases in ENSMUSE00000642194 (exon 20) and is predicted to cause a change of amino acid sequence after residue 1538 and early truncation 9 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|