Wnk2^em1Murr
Endonuclease-mediated Allele Detail

Summary

• Symbol: Wnk2^em1Murr
• Name: WNK lysine deficient protein kinase 2; endonuclease-mediated mutation 1, Stephen Murray
• MGI ID: MGI:5911092
• Gene: Wnk2 Location: Chr13:49189779-49301490 bp, - strand Genetic Position: Chr13, 25.07 cM, cytoband B1
• Alliance: Wnk2^em1Murr page
• IMPC: Wnk2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences AAGCGATAGAGACTTCACCC, GGTCTGCTGGGTGAGGCTTG, GGTCTTGTCACTCAAGGCTG, and TTCACCCTGGAGCCCCTGCG that targeted exon(s) ENSMUSE00000642194.2. This resulted in deletion(s) of 6 bp (location: Chr13:49214256-49214261; GRCm39), 7 bp (location: Chr13:49214222-49214228; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Wnk2 Mutation: 78 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)