About   Help   FAQ
Wnk2em1Murr
Endonuclease-mediated Allele Detail
Summary
Symbol: Wnk2em1Murr
Name: WNK lysine deficient protein kinase 2; endonuclease-mediated mutation 1, Stephen Murray
MGI ID: MGI:5911092
Gene: Wnk2  Location: Chr13:49189779-49301490 bp, - strand  Genetic Position: Chr13, 25.07 cM, cytoband B1
Alliance: Wnk2em1Murr page
IMPC: Wnk2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AAGCGATAGAGACTTCACCC, TTCACCCTGGAGCCCCTGCG, CAGCCTTGAGTGACAAGACC and CAAGCCTCACCCAGCAGACC, which resulted in 2 small deletions, a 7 bp (GGCTGAG) deletion beginning at Chromosome 13 positive strand position 49,060,745 bp and ending after 49,060,752 bp, followed 27 bp later by a 6 bp deletion (GTGGAG) beginning at Chromosome 13 positive strand position 49,060,753 bp and ending after 49,060,759 bp (GRCm38/mm10). This mutation deletes 13 total bases in ENSMUSE00000642194 (exon 20) and is predicted to cause a change of amino acid sequence after residue 1538 and early truncation 9 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Wnk2 Mutation:  78 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory