About   Help   FAQ
Yeats2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Yeats2em1(IMPC)J
Name: YEATS domain containing 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5910402
Gene: Yeats2  Location: Chr16:19959813-20051323 bp, + strand  Genetic Position: Chr16, 12.37 cM
Alliance: Yeats2em1(IMPC)J page
IMPC: Yeats2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GCTGCTGATTTTAAATCAGT, CTGCATGAAACTGTAAGATA and GAGAACACTAAATTTATGGG, which resulted in a 176 bp deletion beginning at Chromosome 16 positive strand position 20,152,865 bp, and ending after 20,153,040 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001279853 (exon 3) and 78 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2 bp intronic deletion 48 bp after the 176 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 34 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Yeats2 Mutation:  86 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory