About   Help   FAQ
Cracdem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cracdem1(IMPC)J
Name: capping protein inhibiting regulator of actin; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5910368
Gene: Cracd  Location: Chr5:76804359-77021392 bp, + strand  Genetic Position: Chr5, 41.34 cM, cytoband E1
Alliance: Cracdem1(IMPC)J page
IMPC: Cracd gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Hypomorph)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CGGCGCTCTTAACATCCAGA, CATGTTGGTTAGGGAGGTGT, GGAACACCTCAGTTAGGAAC and CCCTTCAGTCTGGGTAGTAG, which resulted in a 3153 bp deletion beginning at Chromosome 5 positive strand position 76,856,248 bp and ending after 76,859,400 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000719827 (exon 6) and 338 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 179 and early truncation 15 amino acids later. In situ hybridization and qPCR confirmed reduced mRNA levels, indicating a hypomorphic allele. (J:188991, J:278327)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 7 assay results
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cracd Mutation:  54 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory