Exoc2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Exoc2em1(IMPC)J |
Name: |
exocyst complex component 2; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5909206 |
Gene: |
Exoc2 Location: Chr13:30972939-31162082 bp, - strand Genetic Position: Chr13, Syntenic
|
Alliance: |
Exoc2em1(IMPC)J page
|
IMPC: |
Exoc2 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GGTAAAATTAAAGAACCAAA, ATATTTAGGGATATCCCACAand GTATTTGTTATAAGGCCAGC, which resulted in a 346 bp deletion beginning at Chromosome 13 negative strand position 30,935,755 bp ATTTGTTATAAGGCCAGCAG, and ending after CATATTTAGGGATATCCCAC at 30,935,410 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000117295 (exon 4) and 219 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 98 and early truncation 8 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
3 reference(s) |
|