Exoc2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Exoc2em1(IMPC)J |
| Name: |
exocyst complex component 2; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5909206 |
| Synonyms: |
Exoc2- |
| Gene: |
Exoc2 Location: Chr13:30968416-31158076 bp, - strand Genetic Position: Chr13, Syntenic
|
| Alliance: |
Exoc2em1(IMPC)J page
|
| IMPC: |
Exoc2 gene page |
|
Exoc2em1(IMPC)J/Exoc2em1(IMPC)J mice exhibit embryonic lethality after E3.5 but before E7.5. Blastocysts grown in vitro fail to hatch from the zona pellucida.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GGTAAAATTAAAGAACCAAA, ATATTTAGGGATATCCCACAand GTATTTGTTATAAGGCCAGC, which resulted in a 346 bp deletion beginning at Chromosome 13 negative strand position 30,935,755 bp ATTTGTTATAAGGCCAGCAG, and ending after CATATTTAGGGATATCCCAC at 30,935,410 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000117295 (exon 4) and 219 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 98 and early truncation 8 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|