About   Help   FAQ
Utp4em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Utp4em1(IMPC)J
Name: UTP4 small subunit processome component; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5907896
Synonyms: Cirh1aem1(IMPC)J, Utp4-
Gene: Utp4  Location: Chr8:107620268-107649720 bp, + strand  Genetic Position: Chr8, 53.32 cM
Alliance: Utp4em1(IMPC)J page
IMPC: Utp4 gene page
Utp4em1(IMPC)J/Utp4em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as dying morulae but not at E7.5. Mutants fail to hatch from the zona pellucida and are dead after 3 days in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences CCAAAACAGCTTGTGAGACG, GAAGAAACGCTTGTGCATGG and ACAGCATATCCTATAGCCAC, which resulted in a 236 bp deletion beginning at Chromosome 8 positive strand position 106,898,379 bp, GCATGGGGGTATTAGTTCTG, and ending after GGACAGGATATTTTCCTGTG at 106,898,614 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000517277 (exon 4) and 151 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 35 bp intronic deletion (TTCCCCGTCTCACAAGCTGTTTTGGTTTGTTTTGA, 8:106,898,306- 106,898,340) 38 bp before the 236 bp deletion that will not alter the result of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 119 and early truncation 17 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Utp4 Mutation:  42 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory