Utp4em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Utp4em1(IMPC)J |
| Name: |
UTP4 small subunit processome component; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5907896 |
| Synonyms: |
Cirh1aem1(IMPC)J, Utp4- |
| Gene: |
Utp4 Location: Chr8:107620268-107649720 bp, + strand Genetic Position: Chr8, 53.32 cM
|
| Alliance: |
Utp4em1(IMPC)J page
|
| IMPC: |
Utp4 gene page |
|
Utp4em1(IMPC)J/Utp4em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as dying morulae but not at E7.5. Mutants fail to hatch from the zona pellucida and are dead after 3 days in culture.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences CCAAAACAGCTTGTGAGACG, GAAGAAACGCTTGTGCATGG and ACAGCATATCCTATAGCCAC, which resulted in a 236 bp deletion beginning at Chromosome 8 positive strand position 106,898,379 bp, GCATGGGGGTATTAGTTCTG, and ending after GGACAGGATATTTTCCTGTG at 106,898,614 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000517277 (exon 4) and 151 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 35 bp intronic deletion (TTCCCCGTCTCACAAGCTGTTTTGGTTTGTTTTGA, 8:106,898,306- 106,898,340) 38 bp before the 236 bp deletion that will not alter the result of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 119 and early truncation 17 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
5 reference(s) |
|