Utp4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Utp4^em1(IMPC)J
• Name: UTP4 small subunit processome component; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5907896
• Synonyms: Cirh1a^em1(IMPC)J
• Gene: Utp4 Location: Chr8:107620268-107649720 bp, + strand Genetic Position: Chr8, 53.32 cM
• Alliance: Utp4^em1(IMPC)J page
• IMPC: Utp4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences CCAAAACAGCTTGTGAGACG, GAAGAAACGCTTGTGCATGG and ACAGCATATCCTATAGCCAC, which resulted in a 236 bp deletion beginning at Chromosome 8 positive strand position 106,898,379 bp, GCATGGGGGTATTAGTTCTG, and ending after GGACAGGATATTTTCCTGTG at 106,898,614 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000517277 (exon 4) and 151 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 35 bp intronic deletion (TTCCCCGTCTCACAAGCTGTTTTGGTTTGTTTTGA, 8:106,898,306- 106,898,340) 38 bp before the 236 bp deletion that will not alter the result of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 119 and early truncation 17 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Utp4 Mutation: 42 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)