Zfp407^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp407^em1(IMPC)J
• Name: zinc finger protein 407; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5907859
• Synonyms: Zfp407^-
• Gene: Zfp407 Location: Chr18:84225826-84612815 bp, - strand Genetic Position: Chr18, 57.53 cM
• Alliance: Zfp407^em1(IMPC)J page
• IMPC: Zfp407 gene page

Zfp407^em1(IMPC)J/Zfp407^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Embryos at E3.5 appear as stalled cleavage stage embryos. Mutants fail to hatch from the zona with no further development in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences GCAGTTCTCACCTAGACTGA, GCTCCTGGCTCTCACAGCAA, TGTATGGGTGAGATAATTAT, and TTACCATAACAAAGGGAAGG that targeted exon(s) ENSMUSE00001220921.2. This resulted in deletion(s) of 423 bp (location: Chr18:84570869-84571291; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp407 Mutation: 101 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)