Arhgap11a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Arhgap11a^em1(IMPC)J
• Name: Rho GTPase activating protein 11A; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5907256
• Gene: Arhgap11a Location: Chr2:113661837-113679006 bp, - strand Genetic Position: Chr2, 57.47 cM
• Alliance: Arhgap11a^em1(IMPC)J page
• IMPC: Arhgap11a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Arhgap11a-8693J-5061M was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences ATGGAGAGAATATCTCAAAC, GAATGCGCTAGAGTATCTGA and ATTAGGCAAATAAAGATCTT, which resulted in a 322 bp deletion beginning at Chromosome 2 positive strand position 113,845,222 bp TGAGATATTCTCTCCATTTT, and ending after AGATTAAAACACTGCCTTCA at 113,845,543 bp (GRCm38/mm10). This mutation deletes exon 2 (ENSMUSE00001066810) and 251 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 43 and early truncation 3 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Arhgap11a Mutation: 41 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)