About   Help   FAQ
Arhgap11aem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Arhgap11aem1(IMPC)J
Name: Rho GTPase activating protein 11A; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5907256
Gene: Arhgap11a  Location: Chr2:113661837-113679006 bp, - strand  Genetic Position: Chr2, 57.47 cM
Alliance: Arhgap11aem1(IMPC)J page
IMPC: Arhgap11a gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Arhgap11a-8693J-5061M was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences ATGGAGAGAATATCTCAAAC, GAATGCGCTAGAGTATCTGA and ATTAGGCAAATAAAGATCTT, which resulted in a 322 bp deletion beginning at Chromosome 2 positive strand position 113,845,222 bp TGAGATATTCTCTCCATTTT, and ending after AGATTAAAACACTGCCTTCA at 113,845,543 bp (GRCm38/mm10). This mutation deletes exon 2 (ENSMUSE00001066810) and 251 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 43 and early truncation 3 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Arhgap11a Mutation:  39 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory