About   Help   FAQ
Zscan5bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zscan5bem1(IMPC)J
Name: zinc finger and SCAN domain containing 5B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5905771
Gene: Zscan5b  Location: Chr7:6225277-6242416 bp, + strand  Genetic Position: Chr7, 3.61 cM, cytoband A1
Alliance: Zscan5bem1(IMPC)J page
IMPC: Zscan5b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Zscan5b-8665J-4435M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATTCGTTTATGTGGGATAAT, TATGAATGTTCCCACAACTC, GCCAACACCAGAGTTGAGTT and TACCCTTGTCTGACACTCTT, which resulted in a 370 bp deletion beginning at Chromosome 7 positive strand position 6,233,707 bp, CTCTGGAAAAAAGTGAGTGT, and ending after CCAGAGTTGAGTTTGGACAA at 6,234,076 bp (GRCm38/mm10). This mutation deletes exon 5 and 216 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 187 and early truncation 5 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zscan5b Mutation:  20 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory