About   Help   FAQ
Polr1dem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Polr1dem1(IMPC)J
Name: polymerase (RNA) I polypeptide D; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5904258
Synonyms: Polr1d-
Gene: Polr1d  Location: Chr5:147013860-147048407 bp, + strand  Genetic Position: Chr5, 86.73 cM
Alliance: Polr1dem1(IMPC)J page
IMPC: Polr1d gene page
Polr1dem1(IMPC)J/Polr1dem1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Embryos at E3.5 appear as compacted morula. Morulas fail to hatch from the zona pellucida with apparent cell death and never reach blastocyst stage in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Polr1d-8546J-1608M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATTTGACTCCAGCAAAGAGG, GCCCTGCTGCAAGATGAAAA, AGATAATTGGGCCAAGGTAG and TAGTGTTGGTTCAATTAAGA, which resulted in a 938 bp deletion beginning at Chromosome 5 positive strand position 147,078,255 bp, CATCTTGCAGCAGGGCCTAC, and ending after AACAGATAATTGGGCCAAGG at 147,079,192 bp (GRCm38/mm10). This mutation deletes exon 2 and 386 bp of flanking intronic sequence including the splice acceptor and polyA site and is predicted to generate the first 8 amino acids followed by nonsense mediated decay. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 6 assay results
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Polr1d Mutation:  20 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory