Polr1dem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Polr1dem1(IMPC)J |
| Name: |
polymerase (RNA) I polypeptide D; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5904258 |
| Synonyms: |
Polr1d- |
| Gene: |
Polr1d Location: Chr5:147013860-147048407 bp, + strand Genetic Position: Chr5, 86.73 cM
|
| Alliance: |
Polr1dem1(IMPC)J page
|
| IMPC: |
Polr1d gene page |
|
Polr1dem1(IMPC)J/Polr1dem1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Embryos at E3.5 appear as compacted morula. Morulas fail to hatch from the zona pellucida with apparent cell death and never reach blastocyst stage in culture.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Polr1d-8546J-1608M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATTTGACTCCAGCAAAGAGG, GCCCTGCTGCAAGATGAAAA, AGATAATTGGGCCAAGGTAG and TAGTGTTGGTTCAATTAAGA, which resulted in a 938 bp deletion beginning at Chromosome 5 positive strand position 147,078,255 bp, CATCTTGCAGCAGGGCCTAC, and ending after AACAGATAATTGGGCCAAGG at 147,079,192 bp (GRCm38/mm10). This mutation deletes exon 2 and 386 bp of flanking intronic sequence including the splice acceptor and polyA site and is predicted to generate the first 8 amino acids followed by nonsense mediated decay.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
5 reference(s) |
|