About   Help   FAQ
Msl3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Msl3em1(IMPC)J
Name: MSL complex subunit 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5903077
Gene: Msl3  Location: ChrX:167437113-167456894 bp, - strand  Genetic Position: ChrX, 78.73 cM
Alliance: Msl3em1(IMPC)J page
IMPC: Msl3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Msl3-8574J-299M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAGTCAACTATATTCATACA, AGCTTGTGGAAACACTCTGT, AACTAAGTTTCTGTTCCGAA and GGATCCTATGGTTCACTGTT, which resulted in a 635 bp deletion beginning at Chromosome X negative strand position 168,670,594 bp, GCCACCACTGATGAACCCAA, and ending after TTTATACCCACAGAGTGTTT at 168,669,960 bp (GRCm38/mm10). This mutation deletes exon 5 and 543 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation after residue 127. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Msl3 Mutation:  11 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory