Cybb^em1Hmal
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cybb^em1Hmal
• Name: cytochrome b-245, beta polypeptide; endonuclease-mediated mutation 1, Harry Malech
• MGI ID: MGI:5902368
• Gene: Cybb Location: ChrX:9301493-9354005 bp, - strand Genetic Position: ChrX, 4.3 cM
• Alliance: Cybb^em1Hmal page

Mutation origin

• Strain of Origin: NOD.Cg-Prkdc^scid Il2rg^tm1Wjl/SzJ

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Using CRISPR/Cas9 genome engineering, Cybb is targeted with a specific single guide RNA (GGTACTTACAATGACAAAGA) targeted to exon 1. The mutation is identified as a 235 bp deletion encompassing all of exon 1 and 190 bp of the upstream Cybb promoter. (J:241420)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cybb Mutation: 42 strains or lines available

References

• Original: J:241420 Sweeney CL, et al., CRISPR-Mediated Knockout of Cybb in NSG Mice Establishes a Model of Chronic Granulomatous Disease for Human Stem-Cell Gene Therapy Transplants. Hum Gene Ther. 2017 Jul;28(7):565-575
• All: 1 reference(s)