About   Help   FAQ
Cybbem1Hmal
Endonuclease-mediated Allele Detail
Summary
Symbol: Cybbem1Hmal
Name: cytochrome b-245, beta polypeptide; endonuclease-mediated mutation 1, Harry Malech
MGI ID: MGI:5902368
Gene: Cybb  Location: ChrX:9301493-9354005 bp, - strand  Genetic Position: ChrX, 4.3 cM
Alliance: Cybbem1Hmal page
Mutation
origin
Strain of Origin:  NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsUsing CRISPR/Cas9 genome engineering, Cybb is targeted with a specific single guide RNA (GGTACTTACAATGACAAAGA) targeted to exon 1. The mutation is identified as a 235 bp deletion encompassing all of exon 1 and 190 bp of the upstream Cybb promoter. (J:241420)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Cybb Mutation:  48 strains or lines available
References
Original:  J:241420 Sweeney CL, et al., CRISPR-Mediated Knockout of Cybb in NSG Mice Establishes a Model of Chronic Granulomatous Disease for Human Stem-Cell Gene Therapy Transplants. Hum Gene Ther. 2017 Jul;28(7):565-575
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory