Dhrs11em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Dhrs11em1(IMPC)J |
| Name: |
dehydrogenase/reductase 11; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5902359 |
| Gene: |
Dhrs11 Location: Chr11:84711682-84719820 bp, - strand Genetic Position: Chr11, 51.34 cM
|
| Alliance: |
Dhrs11em1(IMPC)J page
|
| IMPC: |
Dhrs11 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Dhrs11-8573J-5846M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAGAGAGATCCCTATCGGA, AGAGGGATTTAGTATCCAAA, GAGCAGGTGTTAGAGCCGTG and ACTGGTTTCCTGAGGGAGAG, which resulted in a 286 bp deletion beginning at Chromosome 11 negative strand position 84,823,227 bp, CTCTAACACCTGCTCACTGG, and ending after GGGATTTAGTATCCAAACGG at 84,822,942 bp (GRCm38/mm10). This mutation deletes exon 3 and 191 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 119 and early truncation 15 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|