About   Help   FAQ
Dhrs11em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dhrs11em1(IMPC)J
Name: dehydrogenase/reductase 11; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5902359
Gene: Dhrs11  Location: Chr11:84711682-84719820 bp, - strand  Genetic Position: Chr11, 51.34 cM
Alliance: Dhrs11em1(IMPC)J page
IMPC: Dhrs11 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Dhrs11-8573J-5846M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAGAGAGATCCCTATCGGA, AGAGGGATTTAGTATCCAAA, GAGCAGGTGTTAGAGCCGTG and ACTGGTTTCCTGAGGGAGAG, which resulted in a 286 bp deletion beginning at Chromosome 11 negative strand position 84,823,227 bp, CTCTAACACCTGCTCACTGG, and ending after GGGATTTAGTATCCAAACGG at 84,822,942 bp (GRCm38/mm10). This mutation deletes exon 3 and 191 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 119 and early truncation 15 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Dhrs11 Mutation:  14 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/14/2024
MGI 6.23
The Jackson Laboratory