About   Help   FAQ
Zfp189em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp189em1(IMPC)J
Name: zinc finger protein 189; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5883339
Synonyms: Zfp189em1J
Gene: Zfp189  Location: Chr4:49521176-49531517 bp, + strand  Genetic Position: Chr4, 26.55 cM
Alliance: Zfp189em1(IMPC)J page
IMPC: Zfp189 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Zfp189-8388J-M4746 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATAACTTCTCCCACTTTCAG, CCATGCTCCCATTCACTAGG, CCTTTGCTAACAAGGAAGCG and GTAGAAAGATCCGAATCAGA, which resulted in a two-part deletion of 361 bp in total. This deletion begins at Chromosome 4 positive strand position 49,522,267 bp, deletes 5 bp TGAAT, retains 3 endogenous bp (GGG) in the intron and then removes 356 bp ending after AACTCTGGTCTCCCTCGCTT at 49,522,630 bp (GRCm38/mm10). This mutation deletes exon 2 and 276 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 11 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp189 Mutation:  33 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory