Zfp189^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp189^em1(IMPC)J
• Name: zinc finger protein 189; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5883339
• Synonyms: Zfp189^em1J
• Gene: Zfp189 Location: Chr4:49521176-49531517 bp, + strand Genetic Position: Chr4, 26.55 cM
• Alliance: Zfp189^em1(IMPC)J page
• IMPC: Zfp189 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Zfp189-8388J-M4746 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATAACTTCTCCCACTTTCAG, CCATGCTCCCATTCACTAGG, CCTTTGCTAACAAGGAAGCG and GTAGAAAGATCCGAATCAGA, which resulted in a two-part deletion of 361 bp in total. This deletion begins at Chromosome 4 positive strand position 49,522,267 bp, deletes 5 bp TGAAT, retains 3 endogenous bp (GGG) in the intron and then removes 356 bp ending after AACTCTGGTCTCCCTCGCTT at 49,522,630 bp (GRCm38/mm10). This mutation deletes exon 2 and 276 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 11 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp189 Mutation: 31 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)