About   Help   FAQ
Sel1l3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Sel1l3em1(IMPC)J
Name: sel-1 suppressor of lin-12-like 3 (C. elegans); endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5829466
Synonyms: Sel1l3em1J
Gene: Sel1l3  Location: Chr5:53264425-53370794 bp, - strand  Genetic Position: Chr5, 28.96 cM
Alliance: Sel1l3em1(IMPC)J page
IMPC: Sel1l3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Sel1l3-8391J-F4781 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTGTCATCGCACAACAGCA, CAAGAATGTGCTGTGCCACG, ATTCCCGAGCTGGCTTCCGA and AACATCTGCTGATCAAAATG, which resulted in a 928 bp deletion beginning at Chromosome 5 negative strand position 53,200,761 bp CGGAAGCCAGCTCGGGAATG, and ending after GCCGGTGTCATCGCACAACA at 53,199,834 bp (GRCm38/mm10). This mutation deletes exon 2 and 357 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is a 9 bp insertion (TTTTTTTTT) at the deletion site that will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 59 and early truncation 19 amino acids later. (J:188991, J:384794)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Sel1l3 Mutation:  55 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/16/2026
MGI 6.24
The Jackson Laboratory