Sel1l3em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Sel1l3em1(IMPC)J |
Name: |
sel-1 suppressor of lin-12-like 3 (C. elegans); endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5829466 |
Synonyms: |
Sel1l3em1J |
Gene: |
Sel1l3 Location: Chr5:53264425-53370794 bp, - strand Genetic Position: Chr5, 28.96 cM
|
Alliance: |
Sel1l3em1(IMPC)J page
|
IMPC: |
Sel1l3 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Sel1l3-8391J-F4781 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTGTCATCGCACAACAGCA, CAAGAATGTGCTGTGCCACG, ATTCCCGAGCTGGCTTCCGA and AACATCTGCTGATCAAAATG, which resulted in a 928 bp deletion beginning at Chromosome 5 negative strand position 53,200,761 bp CGGAAGCCAGCTCGGGAATG, and ending after GCCGGTGTCATCGCACAACA at 53,199,834 bp (GRCm38/mm10). This mutation deletes exon 2 and 357 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is a 9 bp insertion (TTTTTTTTT) at the deletion site that will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 59 and early truncation 19 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|