About   Help   FAQ
Zfp827em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp827em1(IMPC)J
Name: zinc finger protein 827; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5829404
Synonyms: Zfp827em1J
Gene: Zfp827  Location: Chr8:79755066-79920395 bp, + strand  Genetic Position: Chr8, 37.36 cM
Alliance: Zfp827em1(IMPC)J page
IMPC: Zfp827 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Zfp827-8389J-M1094 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTAGGGTCCAACAGTTCCA, TCAGTCCATGTCCATCTTTT, GCAAGCCTGACGACCGCACA and GGTCTGTGCTCTAAACTCTA, which resulted in a 289 bp deletion beginning at Chromosome 8 positive strand position 79,120,356 bp TTCCATGGATGTTATCTGGA, and ending after TCTAAACTCTATGGATTCAG at 79,120,644 bp (GRCm38/mm10). This mutation deletes exon 7 and 231 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 737 and early truncation 100 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp827 Mutation:  58 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory