Zfp827^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp827^em1(IMPC)J
• Name: zinc finger protein 827; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5829404
• Synonyms: Zfp827^em1J
• Gene: Zfp827 Location: Chr8:79755066-79920395 bp, + strand Genetic Position: Chr8, 37.36 cM
• Alliance: Zfp827^em1(IMPC)J page
• IMPC: Zfp827 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Zfp827-8389J-M1094 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTAGGGTCCAACAGTTCCA, TCAGTCCATGTCCATCTTTT, GCAAGCCTGACGACCGCACA and GGTCTGTGCTCTAAACTCTA, which resulted in a 289 bp deletion beginning at Chromosome 8 positive strand position 79,120,356 bp TTCCATGGATGTTATCTGGA, and ending after TCTAAACTCTATGGATTCAG at 79,120,644 bp (GRCm38/mm10). This mutation deletes exon 7 and 231 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 737 and early truncation 100 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp827 Mutation: 58 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)