About   Help   FAQ
Tbc1d16em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tbc1d16em1(IMPC)J
Name: TBC1 domain family, member 16; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5825264
Synonyms: Tbc1d16em1J
Gene: Tbc1d16  Location: Chr11:119033871-119119325 bp, - strand  Genetic Position: Chr11, 83.34 cM
Alliance: Tbc1d16em1(IMPC)J page
IMPC: Tbc1d16 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Tbc1d16-8341J-M1322 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCAGGCTTAGGGCCACCACA, GCCTCACTACCCAGCCTGGT, TGGCTTGTCGTTCTAAATGG and AGAAAGCCATTGCTGACTGG, which resulted in a 958 bp deletion beginning at Chromosome 11 negative strand position 119,209,527 bp, GACTGGAGGAGACCCAAGTG, and ending after CAGCCTCACTACCCAGCCTG at 119,208,570 bp (GRCm38/mm10). This mutation deletes exon 3 and 360 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an indel 26 bp after the deletion (AGCCAAGA insertion/TTTAG deletion) that will not alter the effect of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 59 and early truncation 145 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tbc1d16 Mutation:  44 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory