Anapc1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Anapc1^em1(IMPC)J
• Name: anaphase promoting complex subunit 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5825199
• Synonyms: Anapc1^em1J
• Gene: Anapc1 Location: Chr2:128452024-128529311 bp, - strand Genetic Position: Chr2, 62.63 cM, cytoband F3
• Alliance: Anapc1^em1(IMPC)J page
• IMPC: Anapc1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Anapc1-8258J-F6238 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCATAATGTATCAAACTTC, GAGATAAATGCTTAAAATCA, AATAATCATCCACAAGCTAA and TTTCTGATGCCGTTAGCTTG, which resulted in a 221 bp deletion beginning at Chromosome 2 positive strand position 128,680,281 bp, GTTTGATACATTATGCAAAA, and ending after CGTCTAATAATCATCCACAA at 128680501 bp (GRCm38/mm10). This mutation deletes exon 4 and 169 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 125 and early truncation 4 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Anapc1 Mutation: 116 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)