About   Help   FAQ
Anapc1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Anapc1em1(IMPC)J
Name: anaphase promoting complex subunit 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5825199
Synonyms: Anapc1em1J
Gene: Anapc1  Location: Chr2:128452024-128529311 bp, - strand  Genetic Position: Chr2, 62.63 cM, cytoband F3
Alliance: Anapc1em1(IMPC)J page
IMPC: Anapc1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Anapc1-8258J-F6238 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCATAATGTATCAAACTTC, GAGATAAATGCTTAAAATCA, AATAATCATCCACAAGCTAA and TTTCTGATGCCGTTAGCTTG, which resulted in a 221 bp deletion beginning at Chromosome 2 positive strand position 128,680,281 bp, GTTTGATACATTATGCAAAA, and ending after CGTCTAATAATCATCCACAA at 128680501 bp (GRCm38/mm10). This mutation deletes exon 4 and 169 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 125 and early truncation 4 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Anapc1 Mutation:  116 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory