About   Help   FAQ
Chmp7em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Chmp7em1(IMPC)J
Name: charged multivesicular body protein 7; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5825131
Synonyms: Chmp7em1J
Gene: Chmp7  Location: Chr14:69954449-69969990 bp, - strand  Genetic Position: Chr14, 36.09 cM
Alliance: Chmp7em1(IMPC)J page
IMPC: Chmp7 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Chmp7-8200J-F4216 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAAATGTAAAAATAACCCA, GCTGATTACTTCCGGACAGT, GTTAATATAATGCCTCTGAG and TGCGACAGACAGCCTGTCCT, which resulted in a 385 bp deletion beginning at Chromosome 14 negative strand position 69,730,348 bp CAGGCTGTCTGTCGCATTAC, and ending after TAGGGTTATATATTCCTTGG at 69,729,964 bp (GRCm38/mm10). This mutation deletes exon 2 and 213 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 100 and early truncation 25 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Chmp7 Mutation:  39 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory