About   Help   FAQ
Igf2bp3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Igf2bp3em1(IMPC)J
Name: insulin-like growth factor 2 mRNA binding protein 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5825102
Synonyms: Igf2bp3em1J
Gene: Igf2bp3  Location: Chr6:49062157-49191891 bp, - strand  Genetic Position: Chr6, 23.82 cM, cytoband B2.3
Alliance: Igf2bp3em1(IMPC)J page
IMPC: Igf2bp3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Igf2bp3-8307J-M0642 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAACAATAACCCAGAAGCA, TGTGCTTCCTCCCTAAAAAG, ACACACAAGAGGCAAGACGA and AAAAGCCACACCCACCCGAA, which resulted in a 447 bp deletion beginning at Chromosome 6 negative strand position 49,213,510 bp CCGAAGGGTCAGCTCTGCAC, and ending after TTGCCTGCGGCCCCTGCTTC at 49,213,064 bp (GRCm38/mm10). This mutation deletes exon 2 and 386 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 59 and early truncation 21 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Igf2bp3 Mutation:  34 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory