About   Help   FAQ
Apmapem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Apmapem1(IMPC)J
Name: adipocyte plasma membrane associated protein; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5825060
Synonyms: Apmapem1J
Gene: Apmap  Location: Chr2:150425000-150450487 bp, - strand  Genetic Position: Chr2, 74.68 cM
Alliance: Apmapem1(IMPC)J page
IMPC: Apmap gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Apmap-8259J-M2499 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTACACAGCTCCCAGACAG, GTTGCCACTGTTGCTCAGGG, CCATACCGCAGACATCCTGA and AACTGTCTTGAGGCCATGGG, which resulted in a 434 bp deletion beginning at Chromosome 2 negative strand position 150,594,667 bp, GTGATGAGACCGTCAGGATG, and ending after TGCCACTGTTGCTCAGGGTG at 150,594,234 bp (GRCm38/mm10). This mutation deletes exon 3 and 318 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 1 bp insertion 43 bases before the deletion that will not affect the result of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 69 and early truncation 15 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 5 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Apmap Mutation:  21 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory