About   Help   FAQ
Pdzrn3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pdzrn3em1(IMPC)J
Name: PDZ domain containing RING finger 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5825050
Synonyms: Pdzrn3em1J
Gene: Pdzrn3  Location: Chr6:101126570-101354858 bp, - strand  Genetic Position: Chr6, 46.95 cM
Alliance: Pdzrn3em1(IMPC)J page
IMPC: Pdzrn3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Pdzrn3-8311J-M0809 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATTAGTTAAGTAACCCGCA, AGGAGGCCGGAGATGCACCC, ACTTCCTCGGAAAATGCCCG and CCCTCCCTATGGCCAAAAGA, which resulted in a 1147 bp deletion beginning at Chromosome 6 negative strand position 101,378,125 bp AAAGAGGGTCGTGAGGCCCC, and ending after CCAGCTGTATCACTCCGTGC at 101,376,979 bp (GRCm38/mm10). This mutation deletes exon 1 and 415 bp of flanking intronic sequence including the translation start site and splice donor and is predicted to cause a null unless there is an alternative ATG that is used. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Pdzrn3 Mutation:  52 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory