About   Help   FAQ
Prpf40aem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Prpf40aem1(IMPC)J
Name: pre-mRNA processing factor 40A; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5818299
Synonyms: Prpf40aem1J
Gene: Prpf40a  Location: Chr2:53024714-53081450 bp, - strand  Genetic Position: Chr2, 30.69 cM, cytoband C1
Alliance: Prpf40aem1(IMPC)J page
IMPC: Prpf40a gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Prpf40a-8143J-F5722 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GATGCGGTCATATTACCACA, AACGTATGGTGGACTTCATT, TTGAAATACATAGCAAGCCT and AGTTTCATGTGTAATCTGTA, which resulted in a 273 bp deletion beginning at Chromosome 2 negative strand position 53,176,555 bp, CTAGGAGTTGAAACCTCTAGA, and ending after AGAGATTGTTCAACAGAAGC at 53,176,283 bp (GRCm38/mm10). This mutation deletes exon 4 and 242 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 126 and early truncation 102 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Prpf40a Mutation:  62 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory