Hlcsem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Hlcsem1(IMPC)J |
| Name: |
holocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase); endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5817955 |
| Synonyms: |
Hlcs-, Hlcsem1J |
| Gene: |
Hlcs Location: Chr16:93929741-94114430 bp, - strand Genetic Position: Chr16, 55.12 cM, cytoband C4
|
| Alliance: |
Hlcsem1(IMPC)J page
|
| IMPC: |
Hlcs gene page |
|
Hlcsem1(IMPC)J/Hlcsem1(IMPC)J mice exhibit embryonic lethality. Embryos are recovered at E7.5 but arrest prior to gastrulation and no embryos are seen at E9.5. Embryos are smaller and form a rudimentary egg cylinder but no primitive streak or gastrulation are seen at E7.5.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AACTGCGTCAGCACCTTCCG, CATGGCTCTAGGACTATGAC, GGACACCTTAGGTTTTTGGC and GAACTTGTAGCTATACAATG, which resulted in a 191 bp deletion beginning at Chromosome 11 negative strand position 121,363,597 bp CAAAAACCTAAGGTGTCCTC, and ending after TGGCTTTCCTCGGAAGGTGC at 121,363,407 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001289443 (exon 2) and 130 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 182 bp deletion spanning Chr11:121,363,645-121,363,826 before the exon deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 49 and early truncation 81 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
5 reference(s) |
|