About   Help   FAQ
Hlcsem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Hlcsem1(IMPC)J
Name: holocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase); endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5817955
Synonyms: Hlcs-, Hlcsem1J
Gene: Hlcs  Location: Chr16:93929741-94114430 bp, - strand  Genetic Position: Chr16, 55.12 cM, cytoband C4
Alliance: Hlcsem1(IMPC)J page
IMPC: Hlcs gene page
Hlcsem1(IMPC)J/Hlcsem1(IMPC)J mice exhibit embryonic lethality. Embryos are recovered at E7.5 but arrest prior to gastrulation and no embryos are seen at E9.5. Embryos are smaller and form a rudimentary egg cylinder but no primitive streak or gastrulation are seen at E7.5.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AACTGCGTCAGCACCTTCCG, CATGGCTCTAGGACTATGAC, GGACACCTTAGGTTTTTGGC and GAACTTGTAGCTATACAATG, which resulted in a 191 bp deletion beginning at Chromosome 11 negative strand position 121,363,597 bp CAAAAACCTAAGGTGTCCTC, and ending after TGGCTTTCCTCGGAAGGTGC at 121,363,407 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001289443 (exon 2) and 130 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 182 bp deletion spanning Chr11:121,363,645-121,363,826 before the exon deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 49 and early truncation 81 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Hlcs Mutation:  43 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory