About   Help   FAQ
Ankrd45em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ankrd45em1(IMPC)J
Name: ankyrin repeat domain 45; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5812890
Synonyms: Ankrd45em1J
Gene: Ankrd45  Location: Chr1:160970261-160998068 bp, + strand  Genetic Position: Chr1, 69.75 cM, cytoband H1
Alliance: Ankrd45em1(IMPC)J page
IMPC: Ankrd45 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Ankrd45-8103J-F3985 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGTTGGGAAGATGTGTGTA, ATGCAGGGACTTGGGTTTTT, GAGTTATCCACTCATAAAGA and TTCTGCCCGGAATTATAGGT, which resulted in a 697 bp deletion beginning at Chromosome 1 positive strand position 161,150,840 bp, CCAAGTCCCTGCATCCCACA and ending after GTTGGTTATAATGTTAGAAA at 161,151,536 bp (GRCm38/mm10). This mutation deletes exon 2 and 344 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp del (A) 23 bp before the 697 bp deletion that will not effect the result of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 25 and early truncation 24 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ankrd45 Mutation:  29 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory