About   Help   FAQ
Arhgap44em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Arhgap44em1(IMPC)J
Name: Rho GTPase activating protein 44; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5806663
Synonyms: Arhgap44em1J
Gene: Arhgap44  Location: Chr11:64892865-65053779 bp, - strand  Genetic Position: Chr11, 40.42 cM
Alliance: Arhgap44em1(IMPC)J page
IMPC: Arhgap44 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Arhgap44-8008J-F4654 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTAGACCCTGACTGCAGAT, ACTTAGTACAAGCACACACA, GCGGGTGGAAGATTTTCAGT and ATAGTTTACTAATATAACTG, which resulted in a 88 bp deletion beginning at Chromosome 11 negative strand position 65,067,147 bp CCTCTGACGACTCTGGCGCA, and ending after TAAGGTGACCCCATGTGTG at 65,067,060 bp (GRCm38/mm10). This mutation deletes 68 bp of exon 4 and 20 bp of 3-prime flanking intronic sequence including the splice donor. The deletion of part of exon 4 but retention of the splice acceptor is predicted to lead to amino acid change after residue 69 and early truncation 3 amino acids later due to read through into intron 5. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Arhgap44 Mutation:  35 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory