About   Help   FAQ
Tmem131lem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tmem131lem1(IMPC)J
Name: transmembrane 131 like; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5804137
Synonyms: Tmem131lem1J
Gene: Tmem131l  Location: Chr3:83804962-83947482 bp, - strand  Genetic Position: Chr3, 37.42 cM
Alliance: Tmem131lem1(IMPC)J page
IMPC: Tmem131l gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project D930015E06Rik-8030J-M9888 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CGAGCCTGAACACCTGGCAA, AGCGCTCCTGTGCCATTGGG, TTTGCCGTGCATTACAAACG and GCCACCCGAGGGGTGAGCCG, which resulted in a 247 bp deletion beginning at Chromosome 3 negative strand position 84,039,415 bp ACGCGGTGTGTTTTTTTGGT and ending after CGAGCCTGAACACCTGGCAA at 84,039,169 bp (GRCm38/mm10). This mutation deletes exon 2 and 176 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 41 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tmem131l Mutation:  75 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory