Ctbs^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ctbs^em1(IMPC)J
• Name: chitobiase; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5804132
• Synonyms: Ctbs^em1J
• Gene: Ctbs Location: Chr3:146156204-146171604 bp, + strand Genetic Position: Chr3, 71.26 cM, cytoband H3
• Alliance: Ctbs^em1(IMPC)J page
• IMPC: Ctbs gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Ctbs-8029J-M7923 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTCTAATCTGCTTTCCAAG, CATTATGCTCTCTTTGGGAG, TTACTGTTATTTAAGGTCCT and ACATCTTAGTTTTATAGCAA, which resulted in a 517 bp deletion beginning at Chromosome 3 positive strand position 146,454,800 bp, CTTGGAAAGCAGATTAGAGG, and ending after TGTTACTGTTATTTAAGGTC at 146,455,316 bp (GRCm38/mm10). This mutation deletes exon 3 and 308 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 90 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ctbs Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)