Ccdc146em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Ccdc146em1(IMPC)J |
Name: |
coiled-coil domain containing 146; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5788754 |
Synonyms: |
Ccdc146em1J |
Gene: |
Ccdc146 Location: Chr5:21497959-21629675 bp, - strand Genetic Position: Chr5, 9.83 cM, cytoband A3
|
Alliance: |
Ccdc146em1(IMPC)J page
|
IMPC: |
Ccdc146 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Ccdc146-7865J-F7713 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGGGCAAAGATCAGAGTTC, AGGTTGTGAATGTGTGAAGA, AGTAACCTATGTGCATCCAC and GATCACTGTTCGTATGCCTG, which resulted in a 297 bp deletion beginning at Chromosome 5 negative strand position 21,333,199 bp CACAGGCATATGGACAGTGA, and ending after TGGGGCAAAGATCAGAGTTC at 21,332,903 bp (GRCm38/mm10). This mutation deletes exon 3 and 214 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp (G) deleted 40 bp before the 297 bp deletion that will not have any effect on the exon deletion that is predicted to cause a change of amino acid sequence after residue 74 and early truncation 4 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|