About   Help   FAQ
Ccdc146em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ccdc146em1(IMPC)J
Name: coiled-coil domain containing 146; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5788754
Synonyms: Ccdc146em1J
Gene: Ccdc146  Location: Chr5:21497959-21629675 bp, - strand  Genetic Position: Chr5, 9.83 cM, cytoband A3
Alliance: Ccdc146em1(IMPC)J page
IMPC: Ccdc146 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Ccdc146-7865J-F7713 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGGGCAAAGATCAGAGTTC, AGGTTGTGAATGTGTGAAGA, AGTAACCTATGTGCATCCAC and GATCACTGTTCGTATGCCTG, which resulted in a 297 bp deletion beginning at Chromosome 5 negative strand position 21,333,199 bp CACAGGCATATGGACAGTGA, and ending after TGGGGCAAAGATCAGAGTTC at 21,332,903 bp (GRCm38/mm10). This mutation deletes exon 3 and 214 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp (G) deleted 40 bp before the 297 bp deletion that will not have any effect on the exon deletion that is predicted to cause a change of amino acid sequence after residue 74 and early truncation 4 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ccdc146 Mutation:  55 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory